ID: 910337055_910337058

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 910337055 910337058
Species Human (GRCh38) Human (GRCh38)
Location 1:86145953-86145975 1:86145974-86145996
Sequence CCTCAAAATTGGTTTCTTTAATC TCTTACATTCTCATGGTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 432} {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!