ID: 910359822_910359830

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 910359822 910359830
Species Human (GRCh38) Human (GRCh38)
Location 1:86404499-86404521 1:86404531-86404553
Sequence CCCAGGTCACGTAATGTTCCACT ATTTCTAGGCTGAGGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 13, 4: 44} {0: 1, 1: 0, 2: 1, 3: 24, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!