ID: 910360224_910360231

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 910360224 910360231
Species Human (GRCh38) Human (GRCh38)
Location 1:86408746-86408768 1:86408765-86408787
Sequence CCCTTTTGGGGAGAGCAGTCGGT CGGTAAATGTCTGGGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!