ID: 910368839_910368847

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 910368839 910368847
Species Human (GRCh38) Human (GRCh38)
Location 1:86494585-86494607 1:86494621-86494643
Sequence CCATTTCCCCACAATTCCTACAT AAAACATGAGGGCTTCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 147, 4: 862} {0: 1, 1: 0, 2: 2, 3: 24, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!