ID: 910395446_910395451

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 910395446 910395451
Species Human (GRCh38) Human (GRCh38)
Location 1:86789182-86789204 1:86789195-86789217
Sequence CCGTGTGCACGGCATGGAGCTGT ATGGAGCTGTGGTACCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 111} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!