ID: 910429021_910429035

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 910429021 910429035
Species Human (GRCh38) Human (GRCh38)
Location 1:87143031-87143053 1:87143080-87143102
Sequence CCTGCCGCCCTCCTCACACAGCG TGCTGGTGGCTCAGCAACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!