ID: 910448932_910448937

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 910448932 910448937
Species Human (GRCh38) Human (GRCh38)
Location 1:87328241-87328263 1:87328256-87328278
Sequence CCCAGGCGCCCGGGTCACTTCAC CACTTCACCCCACCTGATTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 192} {0: 1, 1: 0, 2: 2, 3: 4, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!