ID: 910449596_910449611

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 910449596 910449611
Species Human (GRCh38) Human (GRCh38)
Location 1:87331852-87331874 1:87331892-87331914
Sequence CCCTCTCCCCCTCAGCCTCCTTC TTTCCTTCCAGCAGCTCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 474, 4: 3998} {0: 1, 1: 0, 2: 0, 3: 22, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!