ID: 910449603_910449611

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 910449603 910449611
Species Human (GRCh38) Human (GRCh38)
Location 1:87331870-87331892 1:87331892-87331914
Sequence CCTTCCCGCCCTTGCCCTGCTGT TTTCCTTCCAGCAGCTCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 483} {0: 1, 1: 0, 2: 0, 3: 22, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!