ID: 910462814_910462819

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 910462814 910462819
Species Human (GRCh38) Human (GRCh38)
Location 1:87466882-87466904 1:87466907-87466929
Sequence CCTGAGCCACTCAATTCTTCAGC AAGTTTCAACAGATTTATGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 42, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!