ID: 910493163_910493170

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 910493163 910493170
Species Human (GRCh38) Human (GRCh38)
Location 1:87795392-87795414 1:87795436-87795458
Sequence CCTTGCTGGTTCTGAGCCTCCAG TTCCAAAATGATTTGTCACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!