ID: 910569645_910569653

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 910569645 910569653
Species Human (GRCh38) Human (GRCh38)
Location 1:88684818-88684840 1:88684847-88684869
Sequence CCGCCAAAGCCCTGGCCTGCCAC GGTTTGATTCTGCCTACCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 389} {0: 1, 1: 0, 2: 0, 3: 4, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!