ID: 910574687_910574689

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 910574687 910574689
Species Human (GRCh38) Human (GRCh38)
Location 1:88747528-88747550 1:88747547-88747569
Sequence CCTGACACTCGTTTGAGAAAGAT AGATCCGGTTTCCTGAATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 109} {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!