ID: 910603745_910603748

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 910603745 910603748
Species Human (GRCh38) Human (GRCh38)
Location 1:89059883-89059905 1:89059930-89059952
Sequence CCAACATAGGTCTTTTCCATACA GAAAATAAGTCAATTTTCTCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 146} {0: 1, 1: 0, 2: 4, 3: 42, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!