ID: 910606212_910606218

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 910606212 910606218
Species Human (GRCh38) Human (GRCh38)
Location 1:89087605-89087627 1:89087654-89087676
Sequence CCAAGTCGGCGGCTCCGCTTTCT TTGTAGGTACCTAAACTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 21, 4: 46} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!