ID: 910610054_910610056

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 910610054 910610056
Species Human (GRCh38) Human (GRCh38)
Location 1:89131521-89131543 1:89131565-89131587
Sequence CCATTTTCAATTTGAGTAAATCA ATGTGGAAATGCTAGATCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 434} {0: 1, 1: 0, 2: 8, 3: 74, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!