ID: 910630219_910630224

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 910630219 910630224
Species Human (GRCh38) Human (GRCh38)
Location 1:89346250-89346272 1:89346288-89346310
Sequence CCTGCCATCTTTTGCAGATAACT GGCAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 9, 1: 173, 2: 187, 3: 147, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!