ID: 910637081_910637085

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 910637081 910637085
Species Human (GRCh38) Human (GRCh38)
Location 1:89420563-89420585 1:89420610-89420632
Sequence CCTGAGAAAATTGACCTATTTTA TGTATGGAAAAGACCTATGTTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 11, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!