ID: 910667076_910667080

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 910667076 910667080
Species Human (GRCh38) Human (GRCh38)
Location 1:89737219-89737241 1:89737269-89737291
Sequence CCTTCTGAAAAATACAACGTTAG AAACCTACTTACACAAACCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 33, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!