ID: 910684059_910684062

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 910684059 910684062
Species Human (GRCh38) Human (GRCh38)
Location 1:89898222-89898244 1:89898235-89898257
Sequence CCACATTTATCAAATCTAAAAGC ATCTAAAAGCAATTCATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 367} {0: 1, 1: 0, 2: 1, 3: 18, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!