ID: 910689949_910689955

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 910689949 910689955
Species Human (GRCh38) Human (GRCh38)
Location 1:89955455-89955477 1:89955494-89955516
Sequence CCCTCTTCCCTGAAGACCTTCAT GCTATACCCAGAGCTACATAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 17, 3: 112, 4: 692} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!