ID: 910749243_910749251

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 910749243 910749251
Species Human (GRCh38) Human (GRCh38)
Location 1:90610472-90610494 1:90610512-90610534
Sequence CCCTAGGCTTGGAGCATTGGCAA AGCGGGATTGGGATATTGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!