ID: 910763531_910763536

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 910763531 910763536
Species Human (GRCh38) Human (GRCh38)
Location 1:90758488-90758510 1:90758534-90758556
Sequence CCTGTCTGTTGTAGGTCAGGGTT TTGTGCATAAGAGATTCATCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!