ID: 910792938_910792948

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 910792938 910792948
Species Human (GRCh38) Human (GRCh38)
Location 1:91069850-91069872 1:91069892-91069914
Sequence CCTCGACATCCCTAGGCTCAGAT TTTCAAGTAGCTGGGACTACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 36, 3: 385, 4: 1252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!