ID: 910864846_910864852

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 910864846 910864852
Species Human (GRCh38) Human (GRCh38)
Location 1:91779008-91779030 1:91779049-91779071
Sequence CCAAGGACAGGAGGCAAGATGTC GTGAGCAATGGTGAGAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 225} {0: 1, 1: 0, 2: 2, 3: 28, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!