ID: 910896475_910896480

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 910896475 910896480
Species Human (GRCh38) Human (GRCh38)
Location 1:92075302-92075324 1:92075332-92075354
Sequence CCCTTCTTCGGCAAGCCTGCAGA GTCTCCTCCAGTCCCAGAGCAGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 3, 3: 22, 4: 108} {0: 1, 1: 4, 2: 5, 3: 29, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!