|
Left Crispr |
Right Crispr |
Crispr ID |
910896484 |
910896492 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:92075339-92075361
|
1:92075383-92075405
|
Sequence |
CCAGTCCCAGAGCAGGAGGTGGT |
GGGAGTGGAGACTGGCGTTTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 2, 2: 2, 3: 41, 4: 321} |
{0: 2, 1: 2, 2: 4, 3: 11, 4: 209} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|