ID: 910896484_910896492

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 910896484 910896492
Species Human (GRCh38) Human (GRCh38)
Location 1:92075339-92075361 1:92075383-92075405
Sequence CCAGTCCCAGAGCAGGAGGTGGT GGGAGTGGAGACTGGCGTTTAGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 2, 3: 41, 4: 321} {0: 2, 1: 2, 2: 4, 3: 11, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!