ID: 910934824_910934830

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 910934824 910934830
Species Human (GRCh38) Human (GRCh38)
Location 1:92479216-92479238 1:92479268-92479290
Sequence CCATGGCAAATACATATCCACAC ACTTCTCCACCCTCCTCAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 239} {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!