|
Left Crispr |
Right Crispr |
| Crispr ID |
910949946 |
910949956 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:92635265-92635287
|
1:92635297-92635319
|
| Sequence |
CCTGCCCCCGAGGTGGAGTCTAC |
CAGGCCTCCTTGAGCTGCAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 19, 2: 54, 3: 68, 4: 118} |
{0: 315, 1: 606, 2: 3678, 3: 1241, 4: 795} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|