ID: 910949946_910949957

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 910949946 910949957
Species Human (GRCh38) Human (GRCh38)
Location 1:92635265-92635287 1:92635298-92635320
Sequence CCTGCCCCCGAGGTGGAGTCTAC AGGCCTCCTTGAGCTGCAGTGGG
Strand - +
Off-target summary {0: 2, 1: 19, 2: 54, 3: 68, 4: 118} {0: 322, 1: 631, 2: 3692, 3: 1326, 4: 787}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!