ID: 910954958_910954960

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 910954958 910954960
Species Human (GRCh38) Human (GRCh38)
Location 1:92693027-92693049 1:92693062-92693084
Sequence CCAAAAAAAGCTTCATTAGAAAG TAAGATTTGACCAGGTGCAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 44, 3: 413, 4: 2757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!