ID: 911049658_911049663

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 911049658 911049663
Species Human (GRCh38) Human (GRCh38)
Location 1:93659941-93659963 1:93659963-93659985
Sequence CCCGTCTATGTCCCTTACTGGAC CTATGAGCTCACTAAGAACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 35, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!