ID: 911057378_911057386

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 911057378 911057386
Species Human (GRCh38) Human (GRCh38)
Location 1:93720535-93720557 1:93720560-93720582
Sequence CCACTCGCCTTCCCAGACCACAG CCTGATGGAGACCCGAAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!