ID: 911061490_911061497

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 911061490 911061497
Species Human (GRCh38) Human (GRCh38)
Location 1:93751778-93751800 1:93751803-93751825
Sequence CCCCACAGGCTGGCAGCCTCCAG TGCTCCAACACAAGGGCGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 432} {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!