ID: 911061492_911061503

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 911061492 911061503
Species Human (GRCh38) Human (GRCh38)
Location 1:93751780-93751802 1:93751826-93751848
Sequence CCACAGGCTGGCAGCCTCCAGAC CTGGGGCTGCTGCCCTGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 481} {0: 1, 1: 0, 2: 7, 3: 84, 4: 704}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!