ID: 911064259_911064264

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 911064259 911064264
Species Human (GRCh38) Human (GRCh38)
Location 1:93773630-93773652 1:93773652-93773674
Sequence CCAGTGCCTATAAAGTATAGGAC CTGGATTTCCACATGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55} {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!