ID: 911072686_911072692

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 911072686 911072692
Species Human (GRCh38) Human (GRCh38)
Location 1:93845194-93845216 1:93845214-93845236
Sequence CCAATACCCCAGGCAGAATTCCT CCTCTGTATGGTTTTCCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 157} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!