ID: 911075710_911075712

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 911075710 911075712
Species Human (GRCh38) Human (GRCh38)
Location 1:93872418-93872440 1:93872437-93872459
Sequence CCGCTAAATTAGGGACAGGATTA ATTATCAGTTTCATAAATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 116} {0: 1, 1: 0, 2: 2, 3: 44, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!