ID: 911094709_911094714

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 911094709 911094714
Species Human (GRCh38) Human (GRCh38)
Location 1:94045903-94045925 1:94045920-94045942
Sequence CCGTGTTCTCCTCTCAGCAGATG CAGATGGCGCTCGGGTCCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!