ID: 911099658_911099664

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 911099658 911099664
Species Human (GRCh38) Human (GRCh38)
Location 1:94085014-94085036 1:94085051-94085073
Sequence CCACAGGTGGATTTTGATTCTGA CTGTAGCAATTGGGGGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206} {0: 1, 1: 1, 2: 1, 3: 15, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!