ID: 911104199_911104208

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 911104199 911104208
Species Human (GRCh38) Human (GRCh38)
Location 1:94117364-94117386 1:94117404-94117426
Sequence CCACATCCTCGGCTTGATGCTGA CAGCTGTCCCAGGTGCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!