ID: 911104431_911104440

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 911104431 911104440
Species Human (GRCh38) Human (GRCh38)
Location 1:94118728-94118750 1:94118764-94118786
Sequence CCCGAGTGGCTCCATCTCCCTGG AGAAGGCAGAGTCCCTGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 285} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!