ID: 911140877_911140884

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 911140877 911140884
Species Human (GRCh38) Human (GRCh38)
Location 1:94501293-94501315 1:94501341-94501363
Sequence CCATAATAGAGGCGTTTGGGAAA CTGCATATATAACTGGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66} {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!