ID: 911210957_911210967

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 911210957 911210967
Species Human (GRCh38) Human (GRCh38)
Location 1:95137510-95137532 1:95137552-95137574
Sequence CCTGTATTTGCAAAGGAATCACA TGATCGTGTTTTGGTGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196} {0: 1, 1: 0, 2: 1, 3: 14, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!