ID: 911217008_911217009

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 911217008 911217009
Species Human (GRCh38) Human (GRCh38)
Location 1:95205902-95205924 1:95205918-95205940
Sequence CCTGGCAGATTCACTGTCTGGTG TCTGGTGAAGACCTGCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 29, 3: 73, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!