ID: 911239525_911239529

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 911239525 911239529
Species Human (GRCh38) Human (GRCh38)
Location 1:95449720-95449742 1:95449743-95449765
Sequence CCAAACATGCAGATTCTCTCTCC AAGCCACATGACTGCTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 95, 4: 487} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!