ID: 911281118_911281120

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 911281118 911281120
Species Human (GRCh38) Human (GRCh38)
Location 1:95930330-95930352 1:95930375-95930397
Sequence CCAAGAAATATGCAAAGACATTC CTGAATCTTGAATGATTTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 46, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!