ID: 911283098_911283102

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 911283098 911283102
Species Human (GRCh38) Human (GRCh38)
Location 1:95955828-95955850 1:95955875-95955897
Sequence CCAATGGAAACCGGACACAGCAG ATGACCATGTCTCCTTTGTTCGG
Strand - +
Off-target summary {0: 60, 1: 138, 2: 107, 3: 135, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!