ID: 911293961_911293964

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 911293961 911293964
Species Human (GRCh38) Human (GRCh38)
Location 1:96090819-96090841 1:96090872-96090894
Sequence CCTCTTTTTTCACAGCTGCATAA TTTAACCAGTACCCCATAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 43, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!