ID: 911381466_911381477

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 911381466 911381477
Species Human (GRCh38) Human (GRCh38)
Location 1:97120353-97120375 1:97120395-97120417
Sequence CCATTTCCTTTCAGCGCCTTTGC CAGCTTTCCTTGAAGACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!